Samples were incubated Target Selective Inhibitor Library manufacturer at 42 °C for 50 min, and the reaction was stopped by heating the samples at 70 °C for 15 min. Samples were cooled at 4 °C for 10 min. Diluted samples from the reverse transcriptase reaction (1:10) underwent real-time PCR amplification using Platinum SYBR QPCR Supermix-UDG and specific primers for AT1R (forward, CACTTTCCTGGATGTGCTGA; reverse, CCCAGAAAGCCGTAGAACAG;

141 bp) and AT2R (forward, CTGCTGGGATTGCCTTAATGA; reverse, AGCAGATGTTTTCTGATTCCAAAGT; 94 bp). Gene expression of GAPDH mRNA was used for normalization (forward, GGTGCTGAGTATGTCGTGGA; reverse, ACTGTGGTCATGAGCCCTTC; 262 bp). Real-time PCRs were performed, recorded, and analyzed using the Corbett Research system (Corbett Life Sciences, Australia). The conditions PLX-4720 cell line for PCR were as follows: 95 °C for 2 min, then 40 cycles of 95 °C for 15 s, 60 °C for 1 min, and 72 °C for 15 s. The specificity of the SYBR Green assay was confirmed by melting point analysis. Expression data were calculated from the cycle threshold (Ct) value using the ΔCt method for quantification [22]. Results were expressed as fold increases. All of the reagents utilized in this method were purchased from Invitrogen (USA). Immunohistochemical assay for detection of angiotensin receptors in portal vein was realized according with the method previously described

[4]. The portal vein was fixed with 4% paraformaldehyde (PFA) solution for 6 h and immersed in sucrose solution (30%) for 12 h. After that, portal vein was embedded in medium for cryosectioning, cut into 8 μm thick sections with

a Leica CM 1850 cryostat (Leica Instruments, Germany), and placed on slides. The vessels were incubated with rabbit anti-goat AT1R or AT2R antibody (IgG; Santa Cruz Biotechnology, USA) at 1:25 and 1:10 dilutions, respectively, at 4 °C for 18 h. Slides were washed with phosphate buffered saline (PBS) and incubated with Immune system biotin-conjugated secondary antibody (diluted 1:1000; Vector Laboratory, USA) at room temperature for 2 h. After incubation, slides were washed with PBS and incubated with the ABC Vectastain kit (Vector Laboratory, USA) at room temperature for 2 h. The signal was revealed by incubating the slides with 3,3-diaminobenzidine (DAB) (Sigma–Aldrich, USA) and 0.06% H2O2 for 30 and 60 s for the AT1R and AT2R antibodies, respectively. The semi-quantitative analysis of staining to AT1R and AT2R antibodies was determined at least in five portal vein slides from each animal and protein expression levels were expressed as arbitrary units determined by optic densitometry with the KS-300 image program (Carl-Zeiss, Germany). Ang II was from Bachem-CA; HOE 140, PD 123319, L-NAME, and indomethacin were from Sigma–Aldrich; losartan was from Merck Sharp & Döhme and celecoxib was from Pfizer.