Table 1 Primers used in the study Loci Primers Sequences Annealing T° (time) Expected size Reference katG F 5′-GAAACAGCGGCGCTGATCGT-3′ 66°C (1 min) 210 bp [21] R 5′- GTTGTCCCATTTCGTCGGGG- 3′ fabGI-inhA F 5′-CCTCGCTGCCCAGAAAGGGA-3′ 64°C (1 min) 248 bp [21] R 5′-ATCCCCCGGTTTCCTCCGGT-3′ inhA (ORF) F 5′- GAACTCGACGTGCAAAAC – 3′ 55°C (45 sec) 207 pb [18] R 5′- CATCGAAGCATACGAATA – 3′ ahpC F 5′-ACCACTGCTTTGCCGCCACC-3′ 65°C (1 min) 237 bp selleck chemicals llc [21] R 5′-CCGATGAGAGCGGTGAGCTG-3′ rpoB F 5′-TCGCCGCGATCAAGGAGT-3′ 62°C (30 sec) 158 bp [21] R 5′-GTGCACGTCGCGGACCTCCA-3′ rrs530 F 5′-GATGACGGCCTTCGGGTTGT-3′

62°C (1 min) 238 bp [12] R 5′- TCTAGTCTGCCCGTATCGCC -3′ rrs912 F 5′- CCI-779 GTAGTCCACGCCGTAAACGG -3′ 62°C (1 min) 240 bp [12] R 5′- AGGCCACAAGGGAACGCCTA -3′ rpsL F 5′- GGCCGACAAACAGAACGT -3′ 58°C (30 sec) 375 bp [12] R 5′- GTTCACCAACTGGGTGAC -3′ embC F 5′- GTTCGACAAGCGCGCCACAC -3′ 65°C (45 sec) 334 bp [22] R 5′- CGGAGGTAGATGGTAGCCGG -3′ embA F 5′-

GCCGGCTATGTAGCCAACTA -3′ 65°C (45 sec) 338 bp [17] R 5′- GACCGTTCCACCAACACC -3′ embB F 5′- CCGACCACGCTGAAACTG -3′ 65°C (45 sec) 368 bp [23] R 5′- GTAATACCAGCCGAAGGGATCCT -3′ gidB F 5′-CGCCGAGTCGTTGTGCT-3′ 62°C (1 min) 886 pb –   R 5′-AGCCTGGCCCGACCTTA-3′       T° = Temperature. Sequencing Purified PCR products were sequenced with the same GNS-1480 primers using the ABI’s Big dye terminator kit (Applied Biosystems, USA) according to the manufacturer’s instructions. At each locus, both forward and reverse primers at each locus were included in order to maximize the coverage of the amplified Farnesyltransferase gene fragment, and the reproducibility of the results. Sequencing reactions include 1 μl big dye, 2 μl sequencing buffer, 0.5 μl of each 2.5 μM primer, a volume of PCR template corresponding approximately to 2–3 ng of DNA, and sufficient distilled water for obtaining

a 10 μl final volume. Unincorporated terminators were removed by treatment on a sephadex column. The obtained sequences were aligned using the assembling application of vector NTI (Invitrogen) and CodonCode Aligner, and polymorphisms detection was achieved by comparison with the published M. tuberculosis H37Rv sequence. Quality control M. tuberculosis H37Rv (ATCC 27294) was included as a quality controls for the phenotypic and genotypic tests. Results Analysis of INH -resistance associated mutation A total of 44 INHR (24 high level and 20 low level)) and 100 matched INHS sensitive control strains were screened for mutations at katG codon 315, the fabG1-inhA regulatory region, the inhA ORF, the oxyR-ahpC intergenic region by DNA sequence analysis. A complete list of specific mutations, which had been identified is provided in Table 2. Table 2 Isoniazid resistance- associated mutations detected in M.